Command-line
Make sure you satisfy the requirements provided below to ensure smooth working of the utility;
System Requirements
Hardware Requirements
A standard computer with around 16 GB RAM
Software Requirements
Python 3.8 or above
Installation
Follow the below steps to install linc2function in your computer.
Login
Upon login to a system and opening a terminal, the following prompt should appear, where the user is the user name and the hostname is the hostname of the system.
user@hostname:~$
Change directory
From the home directory which will be open by default, change to a suitable directory on your computer where the utility needs to be installed. For example, in this tutorial we have changed to workspace directory.
user@hostname:~$ cd workspace
Clone
In the workspace directory, clone the current version of linc2functionpipeline repository from the GitHub.
username@hostname:~/workspace$git clone https://gitlab.com/tyagilab/linc2functionpipeline.git
Open linc2function
Open the linc2function directory that is downloaded from GitHub after cloning.
username@hostname:~/workspace$cd linc2functionpipeline
Python virtual environment
The Python virtual environment encaptulates all the libraries required for the linc2function. All the necessary libraries listed in a requirements.txt file that can be found at the root of the repository. Below are the instructions to create and install dependancies in the Python virtual environment.
Note
linc2function requires Python version 3.8 or higher. For installing Python, please refer the below link: https://www.python.org/downloads/
Create virtual environment
Inside the linc2functionpipeline directory, create a new Python virtual enviroment to conveniently manage all the dependencies required for the utility.
username@hostname:~/workspace/linc2functionpipeline$virtualenv -p python3 .venv
Activate virtual environment
After creating the Python virtual enviroment, activate the virtual enviroment to start using it for subsequent commands. The prompt will change with (.venv) appearing in front of it as shown below;
username@hostname:~/workspace/linc2functionpipeline$source ./venv/bin/activate
(.venv) user@hostname:~/workspace/linc2functionpipeline$
Install dependencies
Install all the required dependencies listed in the requirements.txt file in the newly created Python virtual environment.
(.venv) user@hostname:~/workspace/linc2functionpipeline$pip install -r requirements.txt
Usage
Human Specific Basic (HSB) Model
Execute the following command to invoke Human Specific Basic (HSB) model to predict if a given sequence is a non-coding RNA.
(.venv) username@hostname:~$python3 main.py predict_hs_model <sequence> <mode> <model_path> <scalers_path>
For example;
(.venv) username@hostname:~$python3 main.py predict_hs_model 'ACUCCAGAAUGGGCUCCCUCAGUCGGAAGUCUCCCCGCUCCACCGCCCCCAGUGUAACCCCUCCAACCC' 'basic' /path/to/model.h5 path/to/scaler.pkl
Species Agnostic Basic (SAB) Model
Execute the following command to invoke Species Agnostic Basic (SAB) model to predict if a given sequence is a non-coding RNA.
(.venv) username@hostname:~$python3 main.py predict_sa_model <sequence> <mode> <model_path> <scalers_path>
For example;
(.venv) username@hostname:~$python3 main.py predict_sa_model 'ACUCCAGAAUGGGCUCCCUCAGUCGGAAGUCUCCCCGCUCCACCGCCCCCAGUGUAACCCCUCCAACCC' 'basic' /path/to/model.h5 path/to/scaler.pkl
Human Specific Standard (HSS) Model
Execute the following command to invoke Human Specific Standard (HSS) model to predict if a given sequence is a non-coding RNA.
(.venv) username@hostname:~$python3 main.py predict_hs_model <sequence> <mode> <model_path> <scalers_path>
For example;
(.venv) username@hostname:~$python3 main.py predict_hs_model 'ACUCCAGAAUGGGCUCCCUCAGUCGGAAGUCUCCCCGCUCCACCGCCCCCAGUGUAACCCCUCCAACCC' 'standard' /path/to/model.h5 path/to/scaler.pkl
Species Agnostic Standard (SAS) Model
Execute the following command to invoke Species Agnostic Standard (SAS) model to predict if a given sequence is a non-coding RNA.
(.venv) username@hostname:~$python3 main.py predict_sa_model <sequence> <mode> <model_path> <scalers_path>
For example;
(.venv) username@hostname:~$python3 main.py predict_sa_model 'ACUCCAGAAUGGGCUCCCUCAGUCGGAAGUCUCCCCGCUCCACCGCCCCCAGUGUAACCCCUCCAACCC' 'standard' /path/to/model.h5 path/to/scaler.pkl